exchange efficiency and stability of bispecific antibodies

Bethany September 11, 2020 0 Comments

Sheathless CE-MS as a tool for monitoring exchange efficiency and stability of bispecific antibodies

Bispecific monoclonal antibodies (BsAbs) are receiving great attention due to their extensive benefits as biopharmaceuticals and their involvement in IgG4 mediated autoimmune diseases. While the production of BsAbs is getting more accessible, their analytical characterization remains challenging.

We explored the potential of sheathless CE-MS for monitoring exchange efficiency and stability of in-house produced bispecific antibodies. Two IgG4 bispecific antibodies with different molecular characteristics were prepared using controlled Fab (Fragment antigen binding) -arm exchange. Separation of BsAbs from their parent monospecific antibodies was achieved using a PEI-coated capillary and acidic background electrolytes permitting reliable assessment of the exchange efficiency.

This was especially valuable for a Fab-glycosylated BsAb where the high glycan heterogeneity resulted in an overlap of masses with the monospecific parent antibody, hindering their discrimination by MS only.

The method showed also good capabilities to monitor the stability of the generated BsAbs under different storage conditions. The levels of degradation products were different for the studied antibodies indicating pronounced differences in stability. Overall, the proposed method represents a useful analytical tool for exchange efficiency and stability studies of bispecific antibodies. This article is protected by copyright. All rights reserved.

enviroshieldproducts

anti-IL-8 (3E4D8)
LF-MA30011	Abfrontier	100 ul	EUR 448.8
Description: Mouse Monoclonal to IL-8

Anti-IL-8 antibody
STJ97710	St John's Laboratory	200 µl	EUR 236.4
Description: Mouse monoclonal to IL-8.

Anti-IL-8 antibody
STJ97717	St John's Laboratory	200 µl	EUR 236.4
Description: Mouse monoclonal to IL-8.

Anti-IL-8 antibody
STJ97720	St John's Laboratory	200 µl	EUR 236.4
Description: Mouse monoclonal to IL-8.

Anti-IL-8 antibody
STJ98175	St John's Laboratory	100 µl	EUR 280.8
Description: Mouse monoclonal to IL-8.

1730 8 SNAP-SEAL 8 OZ
1730-8	CORNING	100/pk	EUR 88.8
Description: Disposable Plastic; Plastic Containers

mAb mouse anti-human IL-8
CT264	U-CyTech	0.5 mg	EUR 312

IL-8
E5-00004	EnoGene	1mg	EUR 1152

Anti-IL-8 Monoclonal Antibody
A00423-1	BosterBio	100ul	EUR 476.4
Description: Mouse Monoclonal Antibody for IL-8 Antibody (CXCL8) detection. Tested with IHC in Human, Mouse, Rat.

Individual Reaction Mix 8
G065-8	ABM	200 reactions	EUR 200.4

Swine IL-6 Recombinant Protein
R00102-8	BosterBio	5ug/vial	EUR 310.8
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Swine IL-6 Recombinant Protein is purified interleukin-6 produced in yeast.

Swine IL-4 Recombinant Protein
R00230-8	BosterBio	5ug/vial	EUR 310.8
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Swine IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.

Rabbit IL-2 Recombinant Protein
R00387-8	BosterBio	5ug/vial	EUR 310.8
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Rabbit IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Swine IL-17A Recombinant Protein
R00421-8	BosterBio	5ug/vial	EUR 310.8
Description: IL-17A is a member of the IL-17 family of cytokines, whose members are involved in numerous immune regulatory functions. IL-17 induces the production of many other cytokines, chemokines, and prostaglandins. Swine IL-17A Recombinant Protein is purified interleukin-17A produced in yeast.

Human Interleukin-8 (IL-8) Antibody
13102-05011	AssayPro	150 ug	EUR 248.4

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 418.8

Human IL-8 Antibody
33486-05111	AssayPro	150 ug	EUR 313.2

Human IL-8 Protein
abx060803-25ug	Abbexa	25 ug	EUR 644.4
Shipped within 5-10 working days.

Human IL-8 Protein
abx060804-25ug	Abbexa	25 ug	EUR 644.4
Shipped within 5-10 working days.

Recombinant Human IL-8
P0180	FN Test	100ug	EUR 626.83
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P10145
Description: Recombinant Human protein for IL-8

IL-8/CXCL8, Human
HY-P7224	MedChemExpress	50ug	EUR 596.4

Recombinant Human IL-8
SJB05-01	Amyotop	25µg/vial	EUR 342

Ovine IL-1 beta Recombinant Protein
R00101-8	BosterBio	5ug/vial	EUR 310.8
Description: IL-1 beta (IL-1Î²) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Ovine IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.

Sprint™ 8 Clinical Centrifuge with 8 x 15ml fixed angle rotor, 115V
C5000-8	Benchmark Scientific	1 each	EUR 537.8

Human THSD7a ELISA kit
8-E01A2155	BlueGene	EUR 1524.00 EUR 624.00 EUR 822.00	192 tests 1 plate of 48 wells 1 plate of 96 wells
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human THSD7a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-bovine IL-8 (CXCL8) antibody
STJ15100008	St John's Laboratory	250 µg	EUR 403.2
Description: These monoclonal antibodies enable sensitive and specific detection of bovine IL-8 in ELISpot.

Anti-bovine IL-8 (CXCL8) antibody
STJ15100009	St John's Laboratory	250 µg	EUR 403.2
Description: This monoclonal antibody enables sensitive and specific detection of bovine IL-8 in ELISA.

IL-8 Inhibitor
5-01378	CHI Scientific	4 x 5mg	Ask for price

IL-8 Antibody
BF0238	Affbiotech	200ul	EUR 540

CXCL8/IL-8
E21-C97	EnoGene	10ug	EUR 411.6

CXCL8/IL-8
GT15156	Neuromics	100 ug	EUR 631.2

IL-8 Inhibitor
H-2268.0001	Bachem	1.0mg	EUR 200.4
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

IL-8 Inhibitor
H-2268.0005	Bachem	5.0mg	EUR 691.2
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

IL-8 Inhibitor
H-2268.0025	Bachem	25.0mg	EUR 2648.4
Description: Sum Formula: C45H66N18O7S; CAS# [138559-60-1] net

Bovine(IL-8)
QY-E60063	Qayee Biotechnology	96T	EUR 511.2

IL-8 Antibody
R30420	NSJ Bioreagents	100 ug	EUR 419

IL-8 Antibody
R31932	NSJ Bioreagents	100 ug	EUR 419

IL-8 Antibody
F51235-0.08ML	NSJ Bioreagents	0.08 ml	EUR 165

IL-8 Antibody
F51235-0.4ML	NSJ Bioreagents	0.4 ml	EUR 379

IL-8 Antibody
5149-100	Biovision	each	EUR 405.6

IL-8, Interleukin-8, monkey
RC222-19	Bio Basic	5ug	EUR 125.26
Product category: Proteins/Recombinant Proteins/Cytokines

Human Interleukin 8, IL-8 ELISA KIT
CSB-E04641h-24T	Cusabio	1 plate of 24 wells	EUR 198
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid (CSF), tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 8, IL-8 ELISA KIT
1-CSB-E04641h	Cusabio	EUR 600.00 EUR 4082.40 EUR 2184.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin 8, IL-8 in samples from serum, cell culture supernates, saliva, urine, cerebrospinalfluid(CSF), tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 8(IL-8)ELISA Kit
GA-E0129HM-48T	GenAsia Biotech	48T	EUR 346.8

Human Interleukin 8(IL-8)ELISA Kit
GA-E0129HM-96T	GenAsia Biotech	96T	EUR 559.2

Human Interleukin 8,IL-8 ELISA KIT
201-12-0090	SunredBio	96 tests	EUR 528
This Interleukin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 8 (IL-8) CLIA Kit
abx195916-96tests	Abbexa	96 tests	EUR 990
Shipped within 5-12 working days.

Human Interleukin-8 (IL-8) ELISA Kit
LF-EK60006	Abfrontier	1Ã—96T	EUR 948

Human IL-8(Interleukin 8) ELISA Kit
EH0205	FN Test	96T	EUR 571.5
Detection range: 31.25-2000 pg/ml Uniprot ID: P10145 Alias: IL-8/IL8/CXCL8/GCP-1/GCP1/LECT/LUCT/LYNAP/MDNCF/MONAP/NAF/NAP-1/NAP1/3-10C/AMCF-I/K60
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Interleukin 8(IL-8)ELISA Kit
QY-E04259	Qayee Biotechnology	96T	EUR 433.2

Human IL-8 ELISA kit
CT212A	U-CyTech	5-plate	EUR 554.4

Human IL-8 ELISA Kit
EHI0063	Abclonal	96Tests	EUR 625.2

Human IL-8 ELISA kit
LF-EK50165	Abfrontier	1Ã—96T	EUR 777.6

human IL-8 His tag
E410A07-100	EnoGene	100μg	EUR 1152

IL-8/CXCL8, 72a.a., Human
HY-P7380	MedChemExpress	50ug	EUR 596.4

rec Endothelial IL-8 (human)
H-3742.0010	Bachem	10.0µg	EUR 340.8
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]

rec Endothelial IL-8 (human)
H-3742.0050	Bachem	50.0µg	EUR 1167.6
Description: Sum Formula: C397H644N114O111S4; CAS# [142298-01-9]

rec Monocyte IL-8 (human)
H-9625.0005	Bachem	5.0µg	EUR 194.4
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]

rec Monocyte IL-8 (human)
H-9625.0025	Bachem	25.0µg	EUR 457.2
Description: Sum Formula: C372H600N106O106S4; CAS# [142298-00-8]

IL-8 ELISA KIT\|Human
EF003990	Lifescience Market	96 Tests	EUR 826.8

Recombinant Human IL-8 Protein
RP00052	Abclonal	5 μg	EUR 178.8

IL-8 (Human) ELISA Kit
K4169-100	Biovision	each	EUR 874.8

Bovine Cytokines IL-8(Cytokines IL-8) ELISA Kit
QY-E60102	Qayee Biotechnology	96T	EUR 511.2

Pesticide Mix 8 Containing 15 Compounds in Acetonitrile
SPXPR-8	Scientific Laboratory Supplies	1ML	EUR 249.66

Horse Interleukin 8 (IL-8) ELISA
QY-E120050	Qayee Biotechnology	96T	EUR 573.6

Attenuated Influenza Virions Expressing the SARS-CoV-2 Receptor-Binding Domain Induce Neutralizing Antibodies in Mice

An effective vaccine is essential for controlling the spread of the SARS-CoV-2 virus. Here, we describe an influenza virus-based vaccine for SARS-CoV-2. We incorporated a membrane-anchored form of the SARS-CoV-2 spike receptor binding domain (RBD) in place of the neuraminidase (NA) coding sequence in an influenza virus also possessing a mutation that reduces the affinity of hemagglutinin for its sialic acid receptor.

The resulting ΔNA(RBD)-Flu virus can be generated by reverse genetics and grown to high titers in cell culture. A single-dose intranasal inoculation of mice with ΔNA(RBD)-Flu elicits serum neutralizing antibody titers against SAR-CoV-2 comparable to those observed in humans following natural infection (~1:200).

Furthermore, NA(RBD)-FΔlu itself causes no apparent disease in mice. It might be possible to produce a vaccine similar to ΔNA(RBD)-Flu at scale by leveraging existing platforms for the production of influenza vaccines.

Human monoclonal anti‑TLR4 antibody negatively regulates lipopolysaccharide‑induced inflammatory responses in mouse macrophages

Previous studies have revealed that activation of the Toll‑like receptor 4 (TLR4)‑mediated proinflammatory signaling pathway plays an important role in acute inflammation, sepsis and chronic inflammatory disorders.
Moreover, TLR4 significantly contributes to lipopolysaccharide (LPS)‑induced immune response. Thus, modulation of the TLR4 pathway is an important strategy to specifically target these pathologies.
The aim of the present study was to develop a complete human anti‑TLR4 IgG2 antibody by screening human TLR4 Fab from a phage‑display library and integrating it with constant regions of the heavy chain of human IgG2 via antibody engineering. ELISA, a BLItz system and fluorescence‑activated cell sorting were used to assess its affinity.
Furthermore, mouse‑derived peritoneal macrophages were treated with human anti‑TLR4 IgG2 and induced with LPS in vitro. Reverse transcription‑quantitative PCR and western blotting were used to determine mRNA expression levels of cytokines and phosphorylation levels of signaling pathways, respectively.
It was found that human anti‑TLR4 IgG2 bound to TLR4 with a high affinity of 8.713×10‑10 M, and that preincubation with anti‑TLR4 IgG2 inhibited the LPS‑induced production of tumor necrosis factor‑α, interferon‑β and interleukin‑6 mRNA expression levels in mouse peritoneal macrophages.
It was also demonstrated that human anti‑TLR4 IgG2 inhibited LPS‑induced TLR4 signaling by reducing the phosphorylation of the NF‑κB, mitogen‑activated protein kinase and interferon regulatory factor 3 signaling pathways.
In addition, human anti‑TLR4 IgG2 protected mice from LPS challenge with a survival rate of 40% and also significantly increased the survival time in the cecal ligation and puncture model. Therefore, it was speculated that human anti‑TLR4 IgG2 plays a protective role against sepsis‑associated injury and is potentially applicable for the treatment of infection‑associated immune dysfunction.

Anti-KIR2DL4 antibody
STJ114702	St John's Laboratory	100 µl	EUR 332.4
Description: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the 'framework' loci that is present on all haplotypes. Alternate alleles of this gene are represented on multiple alternate reference loci (ALT_REF_LOCs). Alternative splicing results in multiple transcript variants, some of which may not be annotated on the primary reference assembly.

KIR2DL4 Antibody
DF13591	Affbiotech	100ul	EUR 420

KIR2DL4 antibody
70R-2365	Fitzgerald	50 ug	EUR 560.4
Description: Rabbit polyclonal KIR2DL4 antibody raised against the middle region of KIR2DL4

KIR2DL4 siRNA
20-abx921662	Abbexa	EUR 661.20 EUR 878.40	15 nmol 30 nmol
Shipped within 5-10 working days.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 418.8

Human KIR2DL4 shRNA Plasmid
20-abx952576	Abbexa	EUR 961.20 EUR 1345.20	150 µg 300 µg
Shipped within 15-20 working days.

Human KIR2DL4 ELISA KIT
ELI-21303h	Lifescience Market	96 Tests	EUR 988.8

KIR2DL4 Recombinant Protein (Human)
RP017041	ABM	100 ug	Ask for price

KIR2DL4 cloning plasmid
CSB-CL857457HU-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1134 Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca Show more
Description: A cloning plasmid for the KIR2DL4 gene.

KIR2DL4 Recombinant Protein
91-290	ProSci	0.05 mg	EUR 556.8
Description: Killer cell immunoglobulin-like receptor 2DL4(KIR2DL4) is a Single-pass type I membrane protein and contains 2 Ig-like C2-type (immunoglobulin-like) domains.It belongs to the immunoglobulin superfamily. KIR2DL4 is expressed in all NK cells and some T cells. KIR2DL4 activates the cytotoxicity of NK cells, despite the presence of an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic tail. The ITIM was not necessary for activation of lysis by KIR2DL4. The activation signal of KIR2DL4 was sensitive to inhibition by another ITIM-containing receptor. The activation-deficient mutant of KIR2DL4 inhibited the signal delivered by the activating receptor CD16.

KIR2DL4 Rabbit pAb
A12836-100ul	Abclonal	100 ul	EUR 369.6

KIR2DL4 Rabbit pAb
A12836-200ul	Abclonal	200 ul	EUR 550.8

KIR2DL4 Rabbit pAb
A12836-20ul	Abclonal	20 ul	EUR 219.6

KIR2DL4 Rabbit pAb
A12836-50ul	Abclonal	50 ul	EUR 267.6

KIR2DL4 Blocking Peptide
33R-9831	Fitzgerald	100 ug	EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 Polyclonal Antibody
27806-100ul	SAB	100ul	EUR 302.4

KIR2DL4 Polyclonal Antibody
27806-50ul	SAB	50ul	EUR 224.4

pOTB7-KIR2DL4 Plasmid
PVTB00348	Lifescience Market	2 ug	EUR 427.2

KIR2DL4 ORF Vector (Human) (pORF)
ORF005681	ABM	1.0 ug DNA	EUR 114

KIR2DL4 Polyclonal Conjugated Antibody
C27806	SAB	100ul	EUR 476.4

pEGFP-flag-KIR2DL4 Plasmid
PVTB00348-2a	Lifescience Market	2 ug	EUR 427.2

KIR2DL4 sgRNA CRISPR Lentivector set (Human)
K1150301	ABM	3 x 1.0 ug	EUR 406.8

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 336

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 336

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 336

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody
1-CSB-PA205578	Cusabio	EUR 380.40 EUR 292.80	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody
1-CSB-PA246816	Cusabio	EUR 380.40 EUR 292.80	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody
20-abx210854	Abbexa	EUR 493.20 EUR 360.00	100 ul 50 ul
Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody
20-abx339417	Abbexa	EUR 493.20 EUR 360.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-10ug	Novoprotein	10ug	EUR 157.2
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-1mg	Novoprotein	1mg	EUR 2739.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-500ug	Novoprotein	500ug	EUR 1935.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)
C310-50ug	Novoprotein	50ug	EUR 327.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1150302	ABM	1.0 ug DNA	EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1150303	ABM	1.0 ug DNA	EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1150304	ABM	1.0 ug DNA	EUR 184.8

KIR2DL4 Protein Vector (Human) (pPB-C-His)
PV022721	ABM	500 ng	EUR 394.8

KIR2DL4 Protein Vector (Human) (pPB-N-His)
PV022722	ABM	500 ng	EUR 394.8

KIR2DL4 Protein Vector (Human) (pPM-C-HA)
PV022723	ABM	500 ng	EUR 394.8

KIR2DL4 Protein Vector (Human) (pPM-C-His)
PV022724	ABM	500 ng	EUR 394.8

Recombinant Human KIR2DL4 Protein, His, Insect-1ug
QP12489-1ug	EnQuireBio	1ug	EUR 186

Recombinant Human KIR2DL4 Protein, His, Insect-50ug
QP12489-50ug	EnQuireBio	50ug	EUR 1513.2

Recombinant Human KIR2DL4 Protein, His, Insect-5ug
QP12489-5ug	EnQuireBio	5ug	EUR 241.2

KIR2DL4 3'UTR GFP Stable Cell Line
TU061796	ABM	1.0 ml	EUR 1825.2

KIR2DL4 3'UTR Luciferase Stable Cell Line
TU011796	ABM	1.0 ml	EUR 1825.2

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1150305	ABM	3 x 1.0 ug	EUR 451.2

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody
abx145740-100ug	Abbexa	100 ug	EUR 469.2
Shipped within 5-10 working days.

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1150306	ABM	1.0 ug DNA	EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1150307	ABM	1.0 ug DNA	EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1150308	ABM	1.0 ug DNA	EUR 200.4

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein
PROTQ99706	BosterBio	Regular: 5ug	EUR 380.4
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques.

Anti-Human IgG
DB-173-0.1	DB Biotech	100 μl	EUR 254.4
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-0.2	DB Biotech	200 μl	EUR 357.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-0.5	DB Biotech	500 μl	EUR 460.8
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-1	DB Biotech	1 ml	EUR 735.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-173-RTU-15	DB Biotech	15 ml	EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-173-RTU-7	DB Biotech	7 ml	EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-174-0.1	DB Biotech	100 μl	EUR 254.4
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-0.2	DB Biotech	200 μl	EUR 357.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-0.5	DB Biotech	500 μl	EUR 460.8
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-1	DB Biotech	1 ml	EUR 735.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG
DB-174-RTU-15	DB Biotech	15 ml	EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB-174-RTU-7	DB Biotech	7 ml	EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB173RTU-15	DB Biotech	15 ml	EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB173RTU-7	DB Biotech	7 ml	EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB174RTU-15	DB Biotech	15 ml	EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG
DB174RTU-7	DB Biotech	7 ml	EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-human CCR1
20R-3028	Fitzgerald	200 ug	EUR 704.4
Description: Goat anti-human CCR1 antibody

anti-human RecQL4
AR05-PA0007	Abfrontier	100 ul	EUR 400.8
Description: Rabbit polyclonal to human RecQL4

anti-human Albumin
LF-PA10001	Abfrontier	100 ug	EUR 483.6
Description: Rabbit polyclonal to human Albumin

Goat anti-Human anti-thrombin polyclonal antibody
CABT-L487	Creative Diagnostics	500ug	EUR 858

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L488	Creative Diagnostics	500ug	EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L489	Creative Diagnostics	100ug	EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L490	Creative Diagnostics	100ug	EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody
CABT-L491	Creative Diagnostics	100ug	EUR 795.6

Human anti AMPH(anti amphiphysin) ELISA Kit
EH2621	FN Test	96T	EUR 628.92
Detection range: 31.25-2000 pg/ml Uniprot ID: P49418 Alias: anti-AMPH
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human anti-TPO(anti-thrombopoietin) ELISA Kit
EH4147	FN Test	96T	EUR 628.92
Detection range: 1.563-100 ng/ml Alias: anti-TPO
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens ;Sensitivity: 0.938 ng/ml

Anti-Procalcitonin antibody Mouse anti-human, monoclonal
V100125	AAT Bioquest	50 ug	EUR 367.2
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Anti-Procalcitonin antibody Mouse anti-human, monoclonal
V100126	AAT Bioquest	1 mg	EUR 471.6
R-phrase: H-Phrase: Symbol for dangerous compounds: UNSPEC Code:

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6777.36
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 663.31
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 896.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3672.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 6837.60 EUR 3613.20 EUR 896.40	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Anti-human CD47 mAb
CM096-100ug	SAB	100ug	EUR 416.4

Anti-human CD47 mAb
CM096-25ug	SAB	25ug	EUR 242.4

Anti-human CD45 mAb
CM100-100ug	SAB	100ug	EUR 146.4

Anti-human CD45 mAb
CM100-25ug	SAB	25ug	EUR 103.2

Goat Anti-Human IgA
C020242-1mg	Unibiotest	1mg	EUR 272.4

Goat Anti-Human IgA
C020242-50mg	Unibiotest	50mg	EUR 3162

Anti-Human IgG:HRP Conjugate
F163	Cygnus Technologies	12 ml	EUR 585.6
Product category: Antibodies
Description: Anti-Human IgG:HRP Conjugate by Cygnus Technologies is available in Europe via Gentaur.

anti- Human IgA antibody
FNab04075	FN Test	100µg	EUR 702
Immunogen: immunoglobulin heavy constant alpha 1 Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgA antibody
FNab04076	FN Test	100µg	EUR 702
Recommended dilution: WB: 1:5000-1:50000 IHC: 1:20000-1:100000 Immunogen: immunoglobulin heavy constant alpha 1 Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgA

anti- Human IgG antibody
FNab04077	FN Test	100µg	EUR 702
Recommended dilution: WB: 1:2000-1:20000 Immunogen: Human IgG Research Area: Immunology, Signal Transduction, cancer, stem cells, Metabolism
Description: Antibody raised against Human IgG

Goat anti Human IgE
70R-IG015	Fitzgerald	1 mg	EUR 418.8
Description: Affinity purified Goat anti Human IgE antibody

Goat anti Human IgG
70C-CR6047GAP	Fitzgerald	1 mg	EUR 178.8
Description: Affinity purified Goat anti Human IgG antibody

Goat anti Human IgM
70-B9022GA00-A0	Fitzgerald	5 mg	EUR 230.4
Description: Goat anti Human IgM antibody

Goat anti Human IgG
41C-CB0957	Fitzgerald	5 mg	EUR 415.2
Description: Goat anti Human IgG secondary antibody

Goat anti Human IgG
41C-CB0972	Fitzgerald	2 mg	EUR 316.8
Description: Goat anti Human IgG secondary antibody