Transfer of Proteins From Polyacrylamide Gels to Nitrocellulose Sheets

0 Comments
enviroshieldproducts

Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications

 

A method has been devised for the electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. The method results in quantitative transfer of ribosomal proteins from gels containing urea. For sodium dodecyl sulfate gels, the original band pattern was obtained with no loss of resolution, but the transfer was not quantitative. The method allows detection of proteins by autoradiography and is simpler than conventional procedures.
The immobilized proteins were detectable by immunological procedures. All additional binding capacity on the nitrocellulose was blocked with excess protein; then a specific antibody was bound and, finally, a second antibody directed against the first antibody.
The second antibody was either radioactively labeled or conjugated to fluorescein or to peroxidase. The specific protein was then detected by either autoradiography, under UV light, or by the peroxidase reaction product, respectively. In the latter case, as little as 100 pg of protein was clearly detectable. It is anticipated that the procedure will be applicable to analysis of a wide variety of proteins with specific reactions or ligands.
enviroshieldproducts
enviroshieldproducts

KIR2DL4 Antibody

DF13591 100ul
EUR 420

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 418.8

Human KIR2DL4 shRNA Plasmid

20-abx952576
  • EUR 961.20
  • EUR 1345.20
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL4 ELISA KIT

ELI-21303h 96 Tests
EUR 988.8

KIR2DL4 Recombinant Protein (Human)

RP017041 100 ug Ask for price

KIR2DL4 Rabbit pAb

A12836-100ul 100 ul
EUR 369.6

KIR2DL4 Rabbit pAb

A12836-200ul 200 ul
EUR 550.8

KIR2DL4 Rabbit pAb

A12836-20ul 20 ul
EUR 219.6

KIR2DL4 Rabbit pAb

A12836-50ul 50 ul
EUR 267.6

KIR2DL4 Blocking Peptide

33R-9831 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 Polyclonal Antibody

27806-100ul 100ul
EUR 302.4

KIR2DL4 Polyclonal Antibody

27806-50ul 50ul
EUR 224.4

KIR2DL4 Recombinant Protein

91-290 0.05 mg
EUR 556.8
Description: Killer cell immunoglobulin-like receptor 2DL4(KIR2DL4) is a Single-pass type I membrane protein and contains 2 Ig-like C2-type (immunoglobulin-like) domains.It belongs to the immunoglobulin superfamily. KIR2DL4 is expressed in all NK cells and some T cells. KIR2DL4 activates the cytotoxicity of NK cells, despite the presence of an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic tail. The ITIM was not necessary for activation of lysis by KIR2DL4. The activation signal of KIR2DL4 was sensitive to inhibition by another ITIM-containing receptor. The activation-deficient mutant of KIR2DL4 inhibited the signal delivered by the activating receptor CD16.

KIR2DL4 cloning plasmid

CSB-CL857457HU-10ug 10ug
EUR 279.6
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca
  • Show more
Description: A cloning plasmid for the KIR2DL4 gene.

pOTB7-KIR2DL4 Plasmid

PVTB00348 2 ug
EUR 427.2

KIR2DL4 ORF Vector (Human) (pORF)

ORF005681 1.0 ug DNA
EUR 114

KIR2DL4 Polyclonal Conjugated Antibody

C27806 100ul
EUR 476.4

pEGFP-flag-KIR2DL4 Plasmid

PVTB00348-2a 2 ug
EUR 427.2

KIR2DL4 sgRNA CRISPR Lentivector set (Human)

K1150301 3 x 1.0 ug
EUR 406.8

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 336

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 336

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 336

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx339417
  • EUR 493.20
  • EUR 360.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx210854
  • EUR 493.20
  • EUR 360.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA205578
  • EUR 380.40
  • EUR 292.80
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA246816
  • EUR 380.40
  • EUR 292.80
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-10ug 10ug
EUR 157.2
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-1mg 1mg
EUR 2739.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-500ug 500ug
EUR 1935.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-50ug 50ug
EUR 327.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1150302 1.0 ug DNA
EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1150303 1.0 ug DNA
EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1150304 1.0 ug DNA
EUR 184.8

KIR2DL4 Protein Vector (Human) (pPB-C-His)

PV022721 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPB-N-His)

PV022722 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPM-C-HA)

PV022723 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPM-C-His)

PV022724 500 ng
EUR 394.8

Recombinant Human KIR2DL4 Protein, His, Insect-1ug

QP12489-1ug 1ug
EUR 186

Recombinant Human KIR2DL4 Protein, His, Insect-50ug

QP12489-50ug 50ug
EUR 1513.2

Recombinant Human KIR2DL4 Protein, His, Insect-5ug

QP12489-5ug 5ug
EUR 241.2

KIR2DL4 3'UTR GFP Stable Cell Line

TU061796 1.0 ml
EUR 1825.2

KIR2DL4 3'UTR Luciferase Stable Cell Line

TU011796 1.0 ml
EUR 1825.2

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1150305 3 x 1.0 ug
EUR 451.2

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody

abx145740-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1150306 1.0 ug DNA
EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1150307 1.0 ug DNA
EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1150308 1.0 ug DNA
EUR 200.4

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein

PROTQ99706 Regular: 5ug
EUR 380.4
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques. 

anti-human CCR1

20R-3028 200 ug
EUR 704.4
Description: Goat anti-human CCR1 antibody

anti-human RecQL4

AR05-PA0007 100 ul
EUR 400.8
Description: Rabbit polyclonal to human RecQL4

Anti-Human IgG

DB-173-0.1 100 μl
EUR 254.4
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.2 200 μl
EUR 357.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-0.5 500 μl
EUR 460.8
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-1 1 ml
EUR 735.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-173-RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-173-RTU-7 7 ml
EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-0.1 100 μl
EUR 254.4
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.2 200 μl
EUR 357.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-0.5 500 μl
EUR 460.8
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-1 1 ml
EUR 735.6
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-Human IgG

DB-174-RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB-174-RTU-7 7 ml
EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB173RTU-7 7 ml
EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-7 7 ml
EUR 277.2
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-human Albumin

LF-PA10001 100 ug
EUR 483.6
Description: Rabbit polyclonal to human Albumin

Goat anti-Human anti-thrombin polyclonal antibody

CABT-L487 500ug
EUR 858

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L488 500ug
EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L489 100ug
EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L490 100ug
EUR 795.6

Sheep anti-Human anti-thrombin polyclonal antibody

CABT-L491 100ug
EUR 795.6

Human anti AMPH(anti amphiphysin) ELISA Kit

EH2621 96T
EUR 628.92
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P49418
  • Alias: anti-AMPH
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human anti-TPO(anti-thrombopoietin) ELISA Kit

EH4147 96T
EUR 628.92
  • Detection range: 1.563-100 ng/ml
  • Alias: anti-TPO
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens ;Sensitivity: 0.938 ng/ml

Anti-Procalcitonin antibody *Mouse anti-human, monoclonal *

V100125 50 ug
EUR 367.2
  • R-phrase:
  • H-Phrase:
  • Symbol for dangerous compounds:
  • UNSPEC Code:

Safety, activity, and immune correlates of anti-PD-1 antibody in cancer

BACKGROUND
Blockade of programmed death 1 (PD-1), an inhibitory receptor expressed by T cells, can overcome immune resistance. We assessed the antitumor activity and safety of BMS-936558, an antibody that specifically blocks PD-1.
METHODS
We enrolled patients with advanced melanoma, non-small-cell lung cancer, castration-resistant prostate cancer, or renal-cell or colorectal cancer to receive anti-PD-1 antibody at a dose of 0.1 to 10.0 mg per kilogram of body weight every 2 weeks. Response was assessed after each 8-week treatment cycle. Patients received up to 12 cycles until disease progression or a complete response occurred.
RESULTS
A total of 296 patients received treatment through February 24, 2012. Grade 3 or 4 drug-related adverse events occurred in 14% of patients; there were three deaths from pulmonary toxicity. No maximum tolerated dose was defined. Adverse events consistent with immune-related causes were observed.
Among 236 patients in whom response could be evaluated, objective responses (complete or partial responses) were observed in those with non-small-cell lung cancer, melanoma, or renal-cell cancer. Cumulative response rates (all doses) were 18% among patients with non-small-cell lung cancer (14 of 76 patients), 28% among patients with melanoma (26 of 94 patients), and 27% among patients with renal-cell cancer (9 of 33 patients).
Responses were durable; 20 of 31 responses lasted 1 year or more in patients with 1 year or more of follow-up. To assess the role of intratumoral PD-1 ligand (PD-L1) expression in the modulation of the PD-1-PD-L1 pathway, immunohistochemical analysis was performed on pretreatment tumor specimens obtained from 42 patients. Of 17 patients with PD-L1-negative tumors, none had an objective response; 9 of 25 patients (36%) with PD-L1-positive tumors had an objective response (P=0.006).
CONCLUSIONS
Anti-PD-1 antibody produced objective responses in approximately one in four to one in five patients with non-small-cell lung cancer, melanoma, or renal-cell cancer; the adverse-event profile does not appear to preclude its use. Preliminary data suggest a relationship between PD-L1 expression on tumor cells and objective response. (Funded by Bristol-Myers Squibb and others; ClinicalTrials.gov number, NCT00730639.).

The 1982 revised criteria for the classification of systemic lupus erythematosus.

 

The 1971 preliminary criteria for the classification of systemic lupus erythematosus (SLE) were revised and updated to incorporate new immunologic knowledge and improve disease classification.
The 1982 revised criteria include fluorescence antinuclear antibody and antibody to native DNA and Sm antigen. Some criteria involving the same organ systems were aggregated into single criteria. Raynaud’s phenomenon and alopecia were not included in the 1982 revised criteria because of low sensitivity and specificity.
The new criteria were 96% sensitive and 96% specific when tested with SLE and control patient data gathered from 18 participating clinics. When compared with the 1971 criteria, the 1982 revised criteria showed gains in sensitivity and specificity.

Nori® Mouse CCL-15 (MIP-5) ELISA Kit

GR117261 96-well
EUR 553.2

9998 SCREW CAP 415/15

9998-15 288/pk
EUR 237.6
Description: General Apparatus; Stoppers

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 418.8

Liquid Wicks, Size 15, 200 /pk

W-15 200 WICKS
EUR 22
  • Lead time: 3-5 days
  • Package Quantity: 1
  • size: 200 WICKS
  • Product Size/UNIT QUANTITY: 200
  • Unit: WICKS
  • Qty Description: PACK
  • Ship From Location: Ithaca NY USA
  • Country of Origin: Canada
  • Weight (lbs): 0.1
Description: Liquid Wicks, Size 15, 200 /pk

Human CCL-5 ELISA Kit

EHC0240 96Tests
EUR 625.2

AXYGEN® HORIZONTAL GEL BOX, 15 CM

HGB-15 1/pk
EUR 583.2
Description: Lab Equipment; Axygen Branded EQ

DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm

GFL-15 1 mL
EUR 1263.6

AXYGEN® GEL TRAY 15 X 15 CM FOR USE WITH 15 CM GEL BOX, UV TRANSPARENT

HGB15-15-GT 1/pk
EUR 94.8
Description: Lab Equipment; Axygen Branded EQ

DiagNano Gold Nanoparticle Passive Conjugation Kit, 15 nm

GPK-15 1 kit
EUR 858

Anti-Human IgG

DB173RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human IgG

DB174RTU-15 15 ml
EUR 426
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Normal Rabbit Serum | RS-15-100ML

RS-15-100ML 100 mL
EUR 420
Description:

Normal Rabbit Serum | RS-15-100ML | Immunology Consultants Laboratory

Species Reactivity: Rabbit

Format: Serum

Product Type: Isotype Control

Antibody clonality: Polyclonal

Porcine CCL-5 ELISA Kit

EPC0240 96Tests
EUR 625.2

Rabbit CCL-5 ELISA Kit

ERTC0240 96Tests
EUR 625.2

Rat CCL-5 ELISA Kit

ERC0240 96Tests
EUR 625.2

Mouse CCL-5 ELISA Kit

EMC0240 96Tests
EUR 625.2

Monkey CCL-5 ELISA Kit

EMKC0240 96Tests
EUR 625.2

Goat CCL-5 ELISA Kit

EGTC0240 96Tests
EUR 625.2

Canine CCL-5 ELISA Kit

ECC0240 96Tests
EUR 625.2

Chicken CCL-5 ELISA Kit

ECKC0240 96Tests
EUR 625.2

Anserini CCL-5 ELISA Kit

EAC0240 96Tests
EUR 625.2

Bovine CCL-5 ELISA Kit

EBC0240 96Tests
EUR 625.2

Sheep CCL-5 ELISA Kit

ESC0240 96Tests
EUR 625.2

Anti-Human Kappa Light Chain

DB037RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human Kappa Light Chain

DB038RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Human Lambda Light Chain

DB039RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Sulfur 15 ug/g (15 PPM) for AA and ICP 100 grams in no.2 Diesel Fuel

SDFS-15-Y 100ML
EUR 102.6

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 336

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 336

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 336

Guinea Pig CCL-5 ELISA Kit

EGC0240 96Tests
EUR 625.2

DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 15 nm

GCK-M-15 1 kit
EUR 908.4

DiagNano Fluorophore Labeled Gold Nanoparticles, 15 nm, Cellular Uptake

GFL-15-CU 1mL
EUR 1638

Anti-iNOS

DB003RTU-15 15 ml
EUR 513.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p53

DB026RTU-15 15 ml
EUR 405.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD5

DB027RTU-15 15 ml
EUR 496.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD20

DB041RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD45

DB042RTU-15 15 ml
EUR 405.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163

DB045RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Melanosome

DB049RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD10

DB057RTU-15 15 ml
EUR 496.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD117

DB062RTU-15 15 ml
EUR 405.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD1a

DB071RTU-15 15 ml
EUR 496.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD3

DB082RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD8

DB085RTU-15 15 ml
EUR 496.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-EGFR

DB092RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD7

DB114RTU-15 15 ml
EUR 513.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-MSH2

DB115RTU-15 15 ml
EUR 480
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p63

DB134RTU-15 15 ml
EUR 416.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD23

DB135RTU-15 15 ml
EUR 514.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Desmin

DB148RTU-15 15 ml
EUR 416.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD34

DB151RTU-15 15 ml
EUR 416.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p16

DB152RTU-15 15 ml
EUR 416.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Synaptophysin

DB156RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Braf

DB159RTU-15 15 ml
EUR 850.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-p60

DB203RTU-15 15 ml
EUR 416.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

anti-Calpain 15

YF-PA24745 50 ul
EUR 400.8
Description: Mouse polyclonal to Calpain 15

anti-Cytokeratin 15

YF-PA12886 100 ul
EUR 483.6
Description: Rabbit polyclonal to Cytokeratin 15

anti-Cytokeratin 15

YF-PA12887 100 ug
EUR 483.6
Description: Rabbit polyclonal to Cytokeratin 15

anti-Claudin 15

YF-PA18066 50 ug
EUR 435.6
Description: Mouse polyclonal to Claudin 15

anti-Claudin 15

YF-PA18067 100 ug
EUR 483.6
Description: Rabbit polyclonal to Claudin 15

anti-Kallikrein 15

YF-PA19752 50 ul
EUR 435.6
Description: Mouse polyclonal to Kallikrein 15

Anti-b-actin

DB001RTU-15 15 ml
EUR 318
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Melan A

DB050RTU-15 15 ml
EUR 362.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 7

DB051RTU-15 15 ml
EUR 370.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-S-100

DB055RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cyclin D1

DB066RTU-15 15 ml
EUR 496.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Ki-67

DB070RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-TTF-1

DB089RTU-15 15 ml
EUR 513.6
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 8

DB098RTU-15 15 ml
EUR 370.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 14

DB099RTU-15 15 ml
EUR 362.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 16

DB100RTU-15 15 ml
EUR 362.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 17

DB101RTU-15 15 ml
EUR 362.4
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 18

DB102RTU-15 15 ml
EUR 318
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Cytokeratin 19

DB103RTU-15 15 ml
EUR 318
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-C3d complement

DB106RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-C4d complement

DB107RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-Ki-67

DB111RTU-15 15 ml
EUR 424.8
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Leave a Reply

Your email address will not be published. Required fields are marked *