Transfer of Proteins From Polyacrylamide Gels to Nitrocellulose Sheets

0 Comments
enviroshieldproducts

Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications

 

A method has been devised for the electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. The method results in quantitative transfer of ribosomal proteins from gels containing urea. For sodium dodecyl sulfate gels, the original band pattern was obtained with no loss of resolution, but the transfer was not quantitative. The method allows detection of proteins by autoradiography and is simpler than conventional procedures.
The immobilized proteins were detectable by immunological procedures. All additional binding capacity on the nitrocellulose was blocked with excess protein; then a specific antibody was bound and, finally, a second antibody directed against the first antibody.
The second antibody was either radioactively labeled or conjugated to fluorescein or to peroxidase. The specific protein was then detected by either autoradiography, under UV light, or by the peroxidase reaction product, respectively. In the latter case, as little as 100 pg of protein was clearly detectable. It is anticipated that the procedure will be applicable to analysis of a wide variety of proteins with specific reactions or ligands.
enviroshieldproducts
enviroshieldproducts

KIR2DL4 Recombinant Protein (Human)

RP017041 100 ug Ask for price

KIR2DL4 siRNA

20-abx921662
  • EUR 661.2
  • EUR 878.4
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIR2DL4 ORF Vector (Human) (pORF)

ORF005681 1.0 ug DNA
EUR 114

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA205578
  • EUR 380.4
  • EUR 292.8
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 Antibody

1-CSB-PA246816
  • EUR 380.4
  • EUR 292.8
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4. Recognizes KIR2DL3/KIR2DL1/KIR2DL4/KIR2DS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx210854
  • EUR 493.2
  • EUR 360
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL3 / KIR2DL1 / KIR2DL4 / KIR2DS4 Antibody

20-abx339417
  • EUR 493.2
  • EUR 360
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

KIR2DL4 Polyclonal Antibody

27806-100ul 100ul
EUR 302.4

KIR2DL4 Polyclonal Antibody

27806-50ul 50ul
EUR 224.4

KIR2DL4 Rabbit pAb

A12836-100ul 100 ul
EUR 369.6

KIR2DL4 Rabbit pAb

A12836-200ul 200 ul
EUR 550.8

KIR2DL4 Rabbit pAb

A12836-20ul 20 ul
EUR 219.6

KIR2DL4 Rabbit pAb

A12836-50ul 50 ul
EUR 267.6

KIR2DL4 cloning plasmid

CSB-CL857457HU-10ug 10ug
EUR 279.6
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgtccatgtcacccacggtcatcatcctggcatgtcttgggttcttcttggaccagagtgtgtgggcacacgtgggtggtcaggacaagcccttctgctctgcctggcccagcgctgtggtgcctcaaggaggacacgtgactcttcggtgtcactatcgtcgtgggtttaaca
  • Show more
Description: A cloning plasmid for the KIR2DL4 gene.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-10ug 10ug
EUR 157.2
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-1mg 1mg
EUR 2739.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-500ug 500ug
EUR 1935.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human KIR2DL4/CD158d/KIR103 (C-6His)

C310-50ug 50ug
EUR 327.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

KIR2DL4 Blocking Peptide

33R-9831 100 ug
EUR 216
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIR2DL4 antibody, catalog no. 70R-2365

KIR2DL4 sgRNA CRISPR Lentivector set (Human)

K1150301 3 x 1.0 ug
EUR 406.8

KIR2DL4 Recombinant Protein

91-290 0.05 mg
EUR 556.8
Description: Killer cell immunoglobulin-like receptor 2DL4(KIR2DL4) is a Single-pass type I membrane protein and contains 2 Ig-like C2-type (immunoglobulin-like) domains.It belongs to the immunoglobulin superfamily. KIR2DL4 is expressed in all NK cells and some T cells. KIR2DL4 activates the cytotoxicity of NK cells, despite the presence of an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic tail. The ITIM was not necessary for activation of lysis by KIR2DL4. The activation signal of KIR2DL4 was sensitive to inhibition by another ITIM-containing receptor. The activation-deficient mutant of KIR2DL4 inhibited the signal delivered by the activating receptor CD16.

KIR2DL4 Protein Vector (Human) (pPM-C-HA)

PV022723 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPB-C-His)

PV022721 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPB-N-His)

PV022722 500 ng
EUR 394.8

KIR2DL4 Protein Vector (Human) (pPM-C-His)

PV022724 500 ng
EUR 394.8

KIR2DL4 Polyclonal Conjugated Antibody

C27806 100ul
EUR 476.4

Recombinant Human KIR2DL4 Protein, His, Insect-1ug

QP12489-1ug 1ug
EUR 186

Recombinant Human KIR2DL4 Protein, His, Insect-5ug

QP12489-5ug 5ug
EUR 241.2

Recombinant Human KIR2DL4 Protein, His, Insect-50ug

QP12489-50ug 50ug
EUR 1513.2

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1150302 1.0 ug DNA
EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1150303 1.0 ug DNA
EUR 184.8

KIR2DL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1150304 1.0 ug DNA
EUR 184.8

KIR2DL4 3'UTR GFP Stable Cell Line

TU061796 1.0 ml
EUR 1825.2

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1150305 3 x 1.0 ug
EUR 451.2

KIR2DL4 3'UTR Luciferase Stable Cell Line

TU011796 1.0 ml
EUR 1825.2

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1150306 1.0 ug DNA
EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1150307 1.0 ug DNA
EUR 200.4

KIR2DL4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1150308 1.0 ug DNA
EUR 200.4

Killer Cell Immunoglobulin-Like Receptor 2DL4 (KIR2DL4) Antibody

abx145740-100ug 100 ug
EUR 469.2
  • Shipped within 5-10 working days.

Human KIR2DL3 Antibody

32965-05111 150 ug
EUR 313.2

KIR2DL4 Killer Cell Immunoglobulin-Like Receptor, 2 Domains Long Cytoplasmic Tail 4 Human Recombinant Protein

PROTQ99706 Regular: 5ug
EUR 380.4
Description: KIR2DL4 Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 458 amino acids (24-242 a.a.) and having a molecular mass of 51kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). KIR2DL4 is expressed with a 239 amino acids hIgG-His tag at C-Terminus and purified by proprietary chromatographic techniques. 

anti- KIR2DL3 antibody

FNab04581 100µg
EUR 702
  • Immunogen: killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3
  • Uniprot ID: P43628
  • Gene ID: 3804
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against KIR2DL3

anti- KIR3DL1 antibody

FNab04583 100µg
EUR 702
  • Immunogen: killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
  • Uniprot ID: P43629
  • Gene ID: 3811
  • Research Area: Signal Transduction
Description: Antibody raised against KIR3DL1

Rabbit Anti-Human KIR3DL3 polyclonal antibody

CABT-BL004 100 ul
EUR 702

Human KIR2DL2 ELISA KIT

ELI-23746h 96 Tests
EUR 988.8

Human KIR3DL1 ELISA KIT

ELI-23748h 96 Tests
EUR 988.8

Human KIR2DL1 ELISA KIT

ELI-47905h 96 Tests
EUR 988.8

Human KIR3DL2 ELISA KIT

ELI-47907h 96 Tests
EUR 988.8

Human KIR3DL3 ELISA KIT

ELI-47908h 96 Tests
EUR 988.8

Human KIR2DL3 Antibody (Biotin Conjugate)

32965-05121 150 ug
EUR 442.8

Human KIR2DL5B ELISA KIT

ELI-14141h 96 Tests
EUR 988.8

Human KIR2DL5A ELISA KIT

ELI-08129h 96 Tests
EUR 988.8

KIR2DL3 ELISA KIT|Human

EF010535 96 Tests
EUR 826.8

KIR3DL1 ELISA KIT|Human

EF010537 96 Tests
EUR 826.8

Human KIR3DL3 shRNA Plasmid

20-abx964456
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL1 shRNA Plasmid

20-abx952573
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL2 shRNA Plasmid

20-abx952574
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL3 shRNA Plasmid

20-abx952575
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR3DL1 shRNA Plasmid

20-abx952580
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR3DL2 shRNA Plasmid

20-abx952581
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL5A shRNA Plasmid

20-abx961411
  • EUR 961.2
  • EUR 1345.2
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KIR2DL3 AssayLite Antibody (RPE Conjugate)

32965-05151 150 ug
EUR 513.6

Human KIR2DL3 AssayLite Antibody (APC Conjugate)

32965-05161 150 ug
EUR 513.6

KIR2DL1 ORF Vector (Human) (pORF)

ORF005679 1.0 ug DNA
EUR 114

KIR2DL3 ORF Vector (Human) (pORF)

ORF005680 1.0 ug DNA
EUR 114

KIR3DL1 ORF Vector (Human) (pORF)

ORF005682 1.0 ug DNA
EUR 114

Safety, activity, and immune correlates of anti-PD-1 antibody in cancer

BACKGROUND
Blockade of programmed death 1 (PD-1), an inhibitory receptor expressed by T cells, can overcome immune resistance. We assessed the antitumor activity and safety of BMS-936558, an antibody that specifically blocks PD-1.
METHODS
We enrolled patients with advanced melanoma, non-small-cell lung cancer, castration-resistant prostate cancer, or renal-cell or colorectal cancer to receive anti-PD-1 antibody at a dose of 0.1 to 10.0 mg per kilogram of body weight every 2 weeks. Response was assessed after each 8-week treatment cycle. Patients received up to 12 cycles until disease progression or a complete response occurred.
RESULTS
A total of 296 patients received treatment through February 24, 2012. Grade 3 or 4 drug-related adverse events occurred in 14% of patients; there were three deaths from pulmonary toxicity. No maximum tolerated dose was defined. Adverse events consistent with immune-related causes were observed.
Among 236 patients in whom response could be evaluated, objective responses (complete or partial responses) were observed in those with non-small-cell lung cancer, melanoma, or renal-cell cancer. Cumulative response rates (all doses) were 18% among patients with non-small-cell lung cancer (14 of 76 patients), 28% among patients with melanoma (26 of 94 patients), and 27% among patients with renal-cell cancer (9 of 33 patients).
Responses were durable; 20 of 31 responses lasted 1 year or more in patients with 1 year or more of follow-up. To assess the role of intratumoral PD-1 ligand (PD-L1) expression in the modulation of the PD-1-PD-L1 pathway, immunohistochemical analysis was performed on pretreatment tumor specimens obtained from 42 patients. Of 17 patients with PD-L1-negative tumors, none had an objective response; 9 of 25 patients (36%) with PD-L1-positive tumors had an objective response (P=0.006).
CONCLUSIONS
Anti-PD-1 antibody produced objective responses in approximately one in four to one in five patients with non-small-cell lung cancer, melanoma, or renal-cell cancer; the adverse-event profile does not appear to preclude its use. Preliminary data suggest a relationship between PD-L1 expression on tumor cells and objective response. (Funded by Bristol-Myers Squibb and others; ClinicalTrials.gov number, NCT00730639.).

The 1982 revised criteria for the classification of systemic lupus erythematosus.

 

The 1971 preliminary criteria for the classification of systemic lupus erythematosus (SLE) were revised and updated to incorporate new immunologic knowledge and improve disease classification.
The 1982 revised criteria include fluorescence antinuclear antibody and antibody to native DNA and Sm antigen. Some criteria involving the same organ systems were aggregated into single criteria. Raynaud’s phenomenon and alopecia were not included in the 1982 revised criteria because of low sensitivity and specificity.
The new criteria were 96% sensitive and 96% specific when tested with SLE and control patient data gathered from 18 participating clinics. When compared with the 1971 criteria, the 1982 revised criteria showed gains in sensitivity and specificity.

Rat CCL-5 ELISA Kit

ERC0240 96Tests
EUR 625.2

Goat CCL-5 ELISA Kit

EGTC0240 96Tests
EUR 625.2

Mouse CCL-5 ELISA Kit

EMC0240 96Tests
EUR 625.2

Sheep CCL-5 ELISA Kit

ESC0240 96Tests
EUR 625.2

Monkey CCL-5 ELISA Kit

EMKC0240 96Tests
EUR 625.2

Bovine CCL-5 ELISA Kit

EBC0240 96Tests
EUR 625.2

Rabbit CCL-5 ELISA Kit

ERTC0240 96Tests
EUR 625.2

Canine CCL-5 ELISA Kit

ECC0240 96Tests
EUR 625.2

Porcine CCL-5 ELISA Kit

EPC0240 96Tests
EUR 625.2

Chicken CCL-5 ELISA Kit

ECKC0240 96Tests
EUR 625.2

Anserini CCL-5 ELISA Kit

EAC0240 96Tests
EUR 625.2

Guinea Pig CCL-5 ELISA Kit

EGC0240 96Tests
EUR 625.2

Nori® Ovine CCL-2/MCP-1 ELISA Kit

GR116154 96-well
EUR 461

Rabbit Anti Human Interleukin-15 Polyclonal Antibody

CPBT-65643RH 0.1 mg
EUR 1057.2

Nori® Porcine CCL-2/MCP-1 ELISA Kit

GR113217 96-well
EUR 461

Human Interleukin-15 (IL-15) Antibody

30145-05111 150 ug
EUR 313.2

Anti-Human GCDFP-15 antibody

STJ16100371 1 mL
EUR 1147.2

anti-Claudin 15

YF-PA18066 50 ug
EUR 435.6
Description: Mouse polyclonal to Claudin 15

anti-Claudin 15

YF-PA18067 100 ug
EUR 483.6
Description: Rabbit polyclonal to Claudin 15

anti-Calpain 15

YF-PA24745 50 ul
EUR 400.8
Description: Mouse polyclonal to Calpain 15

anti-Kallikrein 15

YF-PA19752 50 ul
EUR 435.6
Description: Mouse polyclonal to Kallikrein 15

anti-Cytokeratin 15

YF-PA12886 100 ul
EUR 483.6
Description: Rabbit polyclonal to Cytokeratin 15

anti-Cytokeratin 15

YF-PA12887 100 ug
EUR 483.6
Description: Rabbit polyclonal to Cytokeratin 15

IL-15, Interleukin-15, human

RC212-26 2ug
EUR 125.26
  • Product category: Proteins/Recombinant Proteins/Cytokines

Human CCL15/ C-C motif chemokine 15 ELISA Kit

E0373Hu 1 Kit
EUR 685.2

Human CCL15(C-C motif chemokine 15) ELISA Kit

EH0058 96T
EUR 681.12
  • Detection range: 19.5-1250 pg/ml
  • Uniprot ID: Q16663
  • Alias: CCL15(C-C motif chemokine 15)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 11.719pg/ml

Human GDF-15 Antibody

32574-05111 150 ug
EUR 313.2

Human Interleukin-15 (IL-15) Antibody (Biotin Conjugate)

30145-05121 150 ug
EUR 442.8

Anti-CK-15 antibody

STJ190030 200 µl
EUR 236.4
Description: Unconjugated Mouse monoclonal to CK-15 (5A1)

Anti-IL-15 antibody

STJ99006 200 µl
EUR 236.4
Description: Rabbit polyclonal to IL-15.

Anti-GDF-15 Antibody

A2038-100 100 µl
EUR 502.8

Anti-MMP-15 Antibody

A06396 100ul
EUR 476.4
Description: Rabbit Polyclonal MMP-15 Antibody. Validated in WB and tested in Human, Mouse.

Anti-MMP-15 antibody

STJ94276 200 µl
EUR 236.4
Description: Rabbit polyclonal to MMP-15.

Anti-PEA-15 antibody

STJ95018 200 µl
EUR 236.4
Description: Rabbit polyclonal to PEA-15.

Anti-PEA-15 antibody

STJ95019 200 µl
EUR 236.4
Description: Rabbit polyclonal to PEA-15.

Anti-PEA-15 antibody

STJ95020 200 µl
EUR 236.4
Description: Rabbit polyclonal to PEA-15.

Anti-GDF-15 antibody

STJ93253 200 µl
EUR 236.4
Description: Rabbit polyclonal to GDF-15.

Anti-BMP-15 antibody

STJ97345 200 µl
EUR 236.4
Description: Rabbit polyclonal to BMP-15.

Anti-DHHC-15 Antibody

A12099 100ul
EUR 476.4
Description: Rabbit Polyclonal Antibody for DHHC-15 Antibody (ZDHHC15) detection. Tested with WB in Human.

Anti-DHHC-15 antibody

STJ92707 200 µl
EUR 236.4
Description: Rabbit polyclonal to DHHC-15.

Anti-GCDFP-15 antibody

STJ16100370 1 mL
EUR 975.6

Anti-GCDFP-15 antibody

STJ180109 0.1 ml
EUR 255.6

Anti-GCDFP-15 antibody

STJ180290 0.1 ml
EUR 254.4

anti- Cytokeratin 15 antibody

FNab02198 100µg
EUR 606.3
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: keratin 15
  • Uniprot ID: P19012
  • Gene ID: 3866
  • Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15

anti- Cytokeratin 15 antibody

FNab02199 100µg
EUR 658.5
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: keratin 15
  • Uniprot ID: P19012
  • Gene ID: 3866
  • Research Area: Cancer, Immunology
Description: Antibody raised against Cytokeratin 15

anti-15 Lipoxygenase 1

YF-PA10168 100 ug
EUR 483.6
Description: Rabbit polyclonal to 15 Lipoxygenase 1

Anti-Cytokeratin 15 Antibody

A06791 100ul
EUR 476.4
Description: Rabbit Polyclonal Antibody for Cytokeratin 15 Antibody (KRT15) detection.tested for WB in Human, Mouse, Rat, Monkey.

Anti-Cytokeratin 15 antibody

PAab02198 100 ug
EUR 426

Anti-Cytokeratin 15 antibody

STJ92628 200 µl
EUR 236.4
Description: Rabbit polyclonal to Cytokeratin 15.

Anti-Cytokeratin 15 antibody

STJ97982 100 µl
EUR 280.8
Description: Mouse monoclonal to Cytokeratin 15.

anti-p53 (Ab-15)

LF-PA20358 100 ul
EUR 400.8
Description: Rabbit polyclonal to p53

anti-CDC2 (Ab-15)

LF-PA20070 100 ul
EUR 400.8
Description: Rabbit polyclonal to CDC2

anti-HSP27 (Ab-15)

LF-PA20219 100 ul
EUR 400.8
Description: Rabbit polyclonal to HSP27

Anti-Calpain 15 (4E2)

YF-MA15522 100 ug
EUR 435.6
Description: Mouse monoclonal to Calpain 15

Anti-Calpain 15 (2H7)

YF-MA15523 100 ug
EUR 435.6
Description: Mouse monoclonal to Calpain 15

Recombinant Human Interleukin-15/IL-15

C016-10ug 10ug
EUR 242.4
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.0.

Recombinant Human Interleukin-15/IL-15

C016-1mg 1mg
EUR 2203.2
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.0.

Recombinant Human Interleukin-15/IL-15

C016-500ug 500ug
EUR 1557.6
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.0.

Recombinant Human Interleukin-15/IL-15

C016-50ug 50ug
EUR 595.2
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.0.

anti-Protease Inhibitor 15

YF-PA18816 50 ul
EUR 435.6
Description: Mouse polyclonal to Protease Inhibitor 15

Human C-C Motif Chemokine 15 / MIP5 (CCL15) ELISA Kit

abx250196-96tests 96 tests
EUR 904.8
  • Shipped within 5-12 working days.

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit

PRB-5069 96 assays
EUR 686.4

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit

PRB-5069-5 5 x 96 assays
EUR 2739.6

Human Chemokine (C-C motif) ligand 15(CCL15) ELISA Kit

YLA3875HU-48T 48T
EUR 435

Human Chemokine (C-C motif) ligand 15(CCL15) ELISA Kit

YLA3875HU-96T 96T
EUR 562.5

Rabbit Anti Human Ccl17 Polyclonal Antibody

CPBT-65034RH 0.1 mg
EUR 1057.2

Rabbit Anti Human Ccl25 Polyclonal Antibody

CPBT-65036RH 0.1 mg
EUR 1057.2

Leave a Reply

Your email address will not be published. Required fields are marked *